Информације

Да ли додавање антибиотика након 5-10 минута инокулације утиче на принос или раст протеина?

Да ли додавање антибиотика након 5-10 минута инокулације утиче на принос или раст протеина?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Поставио сам исто питање колеги из лабораторије. Рекла је да би то олабавило бактеријске ћелије у медијуму ЛБ и плазмиди би изашли. Је ли то истина? и зашто?


То није тачно. Ако сте заборавили да додате антибиотик пре инокулације, можете га додати пре него што бактерије почну да расту. Обавезно га додајте када је бактерија још унутра фаза кашњења. Ако га додате касније, неће бити ефикасан јер би неке нерезистентне (нетрансформисане) бактерије већ прошириле своју популацију. Ампицилин и канамицин су најефикаснији када бактерије расту. Иако се ови антибиотици сматрају бактерицидним, на крају бисте имали непотребну биомасу у вашој култури.

Дакле, кашњење од 5 минута за Е.цоли није проблем. (Мислим да се ово дешава свима нама: заборавимо да додамо антибиотик).


Протоколи наведени у наставку могу се користити за узгој и одржавање квасца у течним и чврстим медијима

Раст квасца у ИПД бујону

  1. Суспендујте 50 г производа (производ бр. И1375) у 1 л дестиловане воде.
  2. Аутоклавирајте 15 минута на 121 °Ц.
  3. Инокулирајте културе квасца (добивене из бујона/плоча квасца) у епрувете/боце без детерџента које садрже припремљену течну подлогу, погледајте кораке 1 и 2 (медиј не би требало да буде већи од трећине запремине епрувете за културу или петине укупне бочице обим).
  4. Кратко протресите садржај да бисте распршили ћелије.
  5. Узгајати културу у инкубатору за мућкање на 300 о/мин (за боце) или 350 о/мин (за епрувете за културу).

Раст квасца на ИПД агару

  1. Суспендујте 65г производа (Производ бр. И1500) у 1Л дестиловане воде.
  2. Загрејати до кључања уз мешање да се сви састојци потпуно растворе.
  3. Аутоклавирајте 15 минута на 121 °Ц.
  4. Сипајте око 25-30 мЛ агар подлоге на стерилне плоче и оставите да се стегне у комори за ламинарни проток.
  5. Нанесите ћелије (квасац добијен са ИПД плоче)/размажите (квасац добијен из бујонских култура) на плоче са агаром и инкубирајте на 30 °Ц.

Белешка: Појединачне колоније квасца могу се приметити након око 24 сата, али су потребне инкубације у трајању од 48 сати пре него што се могу користити за реплику. Стопа раста култура квасца које користе синтетичке додатке медијуму за испадање је


УВОД

Овај чланак пружа општи ток рада и описује кључна питања која треба узети у обзир при прављењу рекомбинантних селенопротеина у Есцхерицхиа цоли. Селеноцистеин (Сец, У), откривен након што је генетски код (који садржи 20 канонских аминокиселина) првобитно дешифрован, откривено је да кодира стоп кодон у одређеним случајевима (Лабунскии, Хатфиелд, & Гладисхев, 2014 Иосхизава & Боцк, 2009). Сец је пронађен у протеинима у сва три домена живота. Има јединствен и сложен пут транслације који отежава његову инкорпорацију специфичног за локацију, за разлику од процеса за канонске аминокиселине (слика 1). Стратегија описана у наставку смањује сложеност природног пута инкорпорације Сец-а, дајући систем применљив на било који протеин од интереса (детаљи су разматрани у Основним информацијама).


Резултати

ПсИНВ има структуру специфичну за гљиве рђе

ОРФ у пуној дужини ПсИНВ је клониран из цДНК клица уредиоспоре ЦИР32 са специфичним прајмерима. ОРФ оф ПсИНВ садржао 2310 бп, који кодира протеин од 769 аминокиселина. Подаци о секвенци за ПсИНВ су депоновани у ГенБанк под приступним бројем ККС230123. Молекуларна тежина предвиђеног протеина била је 86,66 кДа, а теоретски пИ предвиђеног протеина био је 6,37. Упоређивањем нуклеотидних секвенци ПсИНВ од седам Пст изолата чији су геноми јавно доступни у бази података генома НЦБИ, показало се да је овај ген високо конзервиран у свим Пст расе са не више од три нуклеотидне замене (слика С1.).

Секвенца од 769 аминокиселина ПсИНВ је коришћен као упит за претраживање база података протеина. Инвертазе и из непатогених и из патогених гљива показују велику сличност са ПсИНВ су идентификовани. Реконструисано је филогенетско стабло са укупно 56 гљивичних и четири инвертазе пшенице. Филогенетска анализа је то открила ПсИНВ груписан са другим инвертазама рђе у једној клади (слика 1а). То су показали резултати анализе предвиђања домена ПсИНВ има два 32 Н-терминална домена породице гликозил хидролазе, названа Н1 и Н2, и један 32 Ц-терминални домен породице гликозил хидролазе, назван Ц домен, према бази података породица протеина Пфам. Н домен је био комбинација два (Н1 и Н2) домена. За разлику од инвертаза квасца и неких других патогених гљива, ова има један Н-терминални домен и један Ц-терминални домен (слика 1б). П хире 2 је коришћен за конструисање 3Д молекуларног модела ПсИНВ методом хомолошког моделирања (Келлеи ет ал., 2015), а различите боје су коришћене за обележавање различитих домена са ПиМОЛ-ом (слика 1ц).

Функционална валидација сигналног пептида ПсИНВ

Да би се утврдило да ли ПсИНВ се излучује у ткива домаћина, неколико сајтова за биоинформатичко предвиђање је коришћено да би се разјаснило да ли ПсИНВ има сигнални пептид. Иако сигнални пептид није идентификован помоћу СигналП 4.1, Фобијус је показао да постоји сигнални пептид састављен од 60 аминокиселина кодираних са првих 180 бп ПсИНВ. Сигнални пептид за ПсИНВ је клониран у пСУЦ2 вектор ради даље верификације. Са позитивним и негативним контролама, трансформисани сојеви квасца су инокулисани на медијуму ЦМД-В и ИПРАА медијуму за функционално тестирање. Показало се да сигнални пептид од ПсИНВ је имао исти ефекат на секрецију СУЦ2 као и добро познати сигнални пептиди из гљива, укључујући Пст (Сл. 2) (Гу ет ал., 2011). Овај резултат је потврдио присуство функционалног сигналног пептида у ПсИНВ.

Профили транскрипта од ПсИНВ

Да бисте стекли увид у могућу функцију ПсИНВ у току Пст инфекције, анализирали смо обиље транскрипта ПсИНВ у различитим временским тачкама током процеса инфекције помоћу кРТ-ПЦР. Како су у претходном извештају примећене промене у нивоу шећера у компатибилним и некомпатибилним системима (Цханг ет ал., 2013), профили транскрипта од ПсИНВ анализирани су у два система. У некомпатибилним системима, Пст могао одрживо да расте са ограничењем раста пре него што се очигледна некроза појави на зараженим листовима 13-15 дпи (слика С2). Узорци су прикупљени и за компатибилне и за некомпатибилне системе до 264 хпи када се нове споре производе у компатибилним системима. Уз квантификацију од ПсИНВ профили експресије у различитим компатибилним и некомпатибилним системима инокулисаним са различитим Пст расе, сви резултати показују сличан образац изражавања. У компатибилним системима, израз од ПсИНВ индукује се на почетку процеса инфекције. На 72–168 хпи, нивои транскрипта су се нагло повећали како су се секундарне хифе прошириле и формирале бројне хаусторије (слика 3). Експресија се тада смањила на веома ниске нивое. У некомпатибилним системима, сличан образац експресије као у компатибилним системима примећен је пре 168 хпи, али је пад ове експресије био много спорији од оног у компатибилним системима после 168 хпи. Обиље од ПсИНВ транскрипти током процеса инфекције сугеришу да ПсИНВ игра важну улогу у Пст инфекција.

Хетеролошки израз од ПсИНВ

За карактеризацију ПсИНВ ин С. церевисиае, комплетан ОРФ је клониран С. церевисиае експресиони вектор пДР195. Трансформанти оф С. церевисиае сој СЕИ2102 добијен је трансформацијом или са празним вектором пДР195 или са рекомбинантним плазмидом пДР195::ПсИНВ. Обе врсте трансформаната не показују разлику у расту на СЦ медијуму са глукозом као извором угљеника (Схерман, 1991). Међутим, на СЦ медијуму са сахарозом као јединим извором угљеника, пДР195 трансформанти уопште нису могли да расту, али пДР195::ПсИНВ трансформанти би могли да допуне инвертазу-негативни фенотип овог соја (слика 4а). Овај резултат то потврђује ПсИНВ делује као инвертаза ин виво.

Да то потврдим ПсИНВ делује као права инвертаза ин витро, вектор пПИЦЗαА::ПсИНВ је конструисан за изражавање ПсИНВ ин П. пасторис. Са сигналом алфа фактора који је додат на Н крај ПсИНВ, зрели протеин се излучује у медијум културе. Трансформант са највећим бројем рекомбинантних плазмида интегрисаних у геном гљивице изабран је за индуковану експресију ПсИНВ протеин. Највећа количина израженог протеина је откривена у филтратима културе без ћелија 120 х након индукције. Вестерн блот анализа рекомбинантног протеина је потврдила да је циљни протеин експримиран (слика С3). Активност ензима је детектована хидролизом сахарозе са растворљивим ПсИНВ ин витро. Користећи ДНС колориметријску методу, показало се да се сахароза хидролизује у редукционе шећере (слика 4б). Овај резултат то додатно потврђује ПсИНВ је права инвертаза и сугерише да се експримирани протеин може користити за даљу биохемијску карактеризацију.

Ензимска карактеризација ПсИНВ

Ензимске карактеристике ПсИНВ су изведене са пречишћеним ПсИНВ протеин. Променом температуре инкубације показало се да је оптимална температура од ПсИНВ је ц. 40°Ц (слика 5а). Потврђено је да је оптимални пХ нешто испод пХ 5,0 (слика 5б). Мицхаелис-Ментен кинетика ензима је одређена применом Линевеавер-Бурк методе. Тхе Км је утврђено да износи 19,92 мМ под оптималним условима (слика 5ц). Поред тога, независно су тестирани ефекти јона различитих двовалентних метала и ЕДТА (слика 5д). Јони цинка и гвожђа нису имали утицаја на активност ензима. Насупрот томе, јони бакра су значајно инхибирали активност ензима и чак су могли потпуно потиснути активност. Међутим, јони мангана су двоструко повећали активност ензима. Додавање ЕДТА је довело до смањења активности ензима. Ово сугерише да јони мангана могу бити кофактор ове инвертазе.

Функционална анализа различитих домена

Као што је раније описано, у овом гену је откривена секвенца специфична за гљиве рђе. Због тога су спроведена даља истраживања функција сваког домена. Добијени су фрагменти са делецијама различитих домена и коришћени и за хетерологну експресију и за еукариотску експресију са пуним геном као позитивном контролом. Код хетерологног експресионог система показало се да само ПсИНВΔН1 могао да допуни дефект инвертазе, али је трансформант растао спорије од позитивне контроле (слика 6б). Протеини ПсИНВΔН, ПсИНВΔН1, ПсИНВΔН2 и ПсИНВΔЦ изражен хетерологном експресијом је тестиран на активност инвертазе као што је раније описано (слика С4). ПсИНВΔН, ПсИНВΔН2 и ПсИНВΔЦ није имао никакву активност, док ПсИНВΔН1 је био активан, али је имао нижу активност од ПсИНВ (сл. 6а). Узети заједно, ови резултати указују да су Н2 домен и Ц домен потребни за активност инвертазе, док се чини да домен Н1 регулише ниво активности инвертазе.

ХИГС за ПсИНВ

Због недостатка стабилног система генетске трансформације за Пст, БСМВ-индукована РНАи гена патогена, названа ХИГС, развијена је као корисно средство за проучавање функције патогених гена утишавањем експресије гена и обично се користи у биотрофним патогенима житарица (Новара ет ал., 2010 Нирмала ет ал., 2011 Панвар ет ал., 2013 Цхенг ет ал., 2015). Три независна фрагмента од ПсИНВ су дизајнирани да утишају експресију овог гена током Пст процес инфекције. Три фрагмента су одабрана тако да немају ефекта на експресију гена инвертазе пшенице са не више од 11 узастопних идентичних нуклеотида уочених између ПсИНВ и сви гени инвертазе пшенице приступљени на НЦБИ (слика С5) (Сентхил-Кумар ет ал., 2007). При 10 дпи са БСМВ, биљке инокулисане са БСМВ:00, БСМВ:ПсИНВ1ас, БСМВ:ПсИНВ2ас, БСМВ:ПсИНВ3ас и БСМВ:ПсСРПКЛас све су показале исти фенотип благих симптома хлоротског мозаика, али нису показале значајне дефекте у расту и развоју. Међутим, биљке инокулисане са БСМВ:ТаПДСас показале су озбиљне симптоме Цхл фотоизбељивања, што сугерише да је БСМВ-ХИГС систем добро функционисао (слика 7а). Са биљкама инокулисаним са БСМВ:00 као негативним контролама и биљкама инокулисаним са БСМВ:ПсСРПКЛас као позитивним контролама, фенотипови болести рђе код биљака инокулисаних са ПсИНВ утишавајући конструкти су фотографисани при 14 дпи свежег Пст ЦИР32 уредиоспоре. Значајно смањење спорулације примећено је на листовима пшенице инокулисаним ПсИНВ утишавајући конструкти у поређењу са листовима позитивне контроле (слика 7б). Бројање уредија на зараженим листовима даље подржава овај закључак (слика 7ц). Биомаса од Пст такође показује смањење у ПсИНВ-утишане биљке (слике 7д, С6). Као израз за ПсИНВ је значајно смањен у ПсИНВ-утишане биљке (сл. 7е), ови резултати указују на то ПсЧини се да ИНВ доприноси патогености Пст на лишћу пшенице.

Хистолошка анализа ефекта утишавања ПсИНВ

Цитолошки ефекти утишавања ПсИНВ на Пст раст и развој су одређени у различитим фазама инфекције на 24, 48, 120 и 168 хпи. Код биљака инокулисаних са три ПсИНВ-утишавајући конструкти, није примећена значајна разлика у развоју гљивица у поређењу са биљкама инокулисаним са БСМВ:00 при 24 хпи (Табела С2). Секундарне хифе се нормално формирају у контролним биљкама на 48 хпи, док раст од Пст заостајао ПсИНВ-утишане биљке јер су примарне хифе биле набубреле и нису формиране секундарне хифе (слика 8). На 120 хпи, када су се формирале многе хаусторије, подручја инфекције од Пст ин ПсИНВ-утишане биљке су биле много мање од оних у контролним биљкама. Поред тога, лежиште пустуле сазрело је несавршено када ПсИНВ је утишан на 7 дпи када структура спорулације почне да се формира. Спорулациони слој је био неразвијен и није могао да производи споре. Овај резултат сугерише да ћутање ПсИНВ не само да инхибира раст и развој Пст али има и јаке ефекте на спорулацију.


Дискусија

Теренско тестирање

Практични курс се изводи једном годишње, углавном у три једнонедељне сесије са 18 до 24 студента сваке недеље. Ученици се насумично удружују са партнером како би промовисали формирање интердисциплинарних тимова. Свака група од два ученика је распоређена на радну станицу са биореактором. У овом делу су приказани подаци за одељења од 2012. до 2014. године, са укупним бројем од 178 ученика: 57 (2012), 59 (2013), односно 62 (2014). Оцењено је субјективно мишљење и перцепција студената о предмету. Ово је урађено у оквиру званичне анонимне рутинске евалуације универзитетске наставе немачке покрајине Баден-Виртемберг. Резултати су приказани на слици 5 и обухватају и сопствену процену исхода учења студената као и ниво курса и квалитета наставе.

Од ученика је затражено да одговоре на свако питање на скали од 1 до 5 (нпр. од 1—„веома јасно“ до 5—„уопште не“), као што је описано на слици 5. Студенти су изјавили да им је курс био значајан и њихове студије (питања 1 и 3) и да су и потребна прелиминарна знања као и ниво курса нешто изнад просека (питања 4 и 6). Поред тога, више од 90% ученика из свих разреда пријавило је напредак у знању, бирајући или „1—потпуно тачно“ или „2—углавном тачно“ (питање 5). Упоређујући резултате евалуације, укупна перцепција студената и прихватање лабораторијског курса је позитивна током читаве наставе 2012-2014.

Доказ о учењу ученика

Ученици одељења 2013. и 2014. године учествовали су на кратким писменим припремним и постлабама. Поред тога, сваки учесник је био у обавези да преда лабораторијски дневник по завршетку курса, а практичне вештине студената су праћене и процењене током њиховог боравка у лабораторији.

Упоређујући податке добијене писменим испитом, могао би се оценити исход учења предмета (Табела 3). Предлабски писмени испити су обављени анонимно путем насумично генерисаних тестова који су садржали најмање два питања из сваке категорије према табели 1. Постлаб писмени испити су били слично структурисани и извођени су последњег дана курса. Резиме потенцијалних питања, која се могу користити у ову сврху, дају се као пратеће информације (С2). Одговори ученика су затим оцењени за сваку категорију и класификовани као „изузетно“, „разумно“ или „потребно је побољшати“. Подаци из табеле 3 показују да је у све четири категорије (које одговарају четири циља учења, табела 1), најмање 95% учесника показало барем задовољавајући исход учења (рангиран као „изванредан“ или „разуман“) на постлабским испитима. Поређења ради, ово је постигло само мање од једне четвртине студената у свим категоријама припремних испита.

Питање/задатак (категорија) Изванредан Разумно Треба побољшати
А. Наведите компоненте и периферије типичног малог биореакторског система и поставите их у прави контекст. Потпуна заступљеност свих релевантних компоненти, правилно додељене функције 79 (5)% Већина компоненти и функција исправно додељена 16 (11)% Недостаје неколико виталних компоненти и углавном им је додељена погрешна функција 5 (84)%
Б. Објасните ванмрежну и онлајн аналитику коришћену у овом експерименту и наведите како се кључни параметри ферментације могу издвојити из онлајн података. Потпуна заступљеност примењене онлајн и офлајн аналитике, објашњени принципи мерења и веза са параметрима ферментације (нпр. ОТР) утврђено 32 (5)% Поменута већина принципа са јасним описом метода, без описа везе са параметрима ферментације 65 (19)% Поменуте неке аналитике, нетачан приказ метода, није успостављена веза са карактеристичним параметрима 4 (77)%
Ц. Објасните систем експресије и наведите шта је потребно за производњу рекомбинантног протеина са овим системом. Потпуна заступљеност свих релевантних аспеката (нпр. катаболичка репресија). Поменута генетска поставка и компоненте плазмида 14 (8)% Већина објашњених аспеката, плазмидне компоненте објашњене у одређеној мери 83 (11)% Опис основа нејасан, није помињан плазмид 4 (82)%
Д. Објасните зашто се различити начини рада користе или користе за експеримент, и којој сврси служе. Тачна подела на серијски и доводни режим, објашњење зашто је то неопходно, дате приближне референтне вредности (нпр. стопа раста, приноси) за различите фазе 44 (3)% Прецизна подела на батцх и режим пуњења са основним објашњењем зашто је то неопходно 51 (9)% Подела на серију и напајану серију илустрована, објашњење зашто је то неопходно одсутно или нетачно 5 (88)%
  • Приказани подаци су добијени од укупно 121 ученика из одељења 2013. (59 ученика) и 2014. године (62 ученика). Примери питања за сваку категорију доступни су као пратеће информације С2. Приказано је по једно репрезентативно питање из сваке категорије додељено циљевима учења 3 до 6 (Табела 1), које је оцењено према горе датим смерницама.

Додатно, развијени су критеријуми за класификацију понашања ученика током практичног дела експеримента. Ови критеријуми, поред опште организације као што је већ поменуто, обухватају способност студената да се ангажују у тимском раду, као и чистоћу радне станице, способности које је иначе веома тешко проценити на писменим испитима. Главни критеријуми за класификацију дати су у табели 4, а детаљна листа се може наћи у пратећим информацијама С4. Процена је вршена редовним неформалним интервјуима у лабораторији са повезаним пробним испитивањем од стране супервизора. Користећи ову методу, инструктори су могли да прате експеримент без превеликог притиска на ученике. Према томе, потешкоће у разумевању појединачних учесника могле би се рано идентификовати и правилно решити, што је утврђено као погодно средство да се узме у обзир потенцијална варијабилна позадина ученика. Према овој процедури, исход учења ученика у практичном делу је класификован као „изванредан“, „разуман“ или „треба побољшања“. Резултати ове класификације приказани су у табели 4. Приближно 92% ученика је показало барем задовољавајуће понашање и вештине.

Питање/задатак Изванредан Разумно Треба побољшати
Научна анализа и документовање података у индивидуалном лабораторијском дневнику студената. Комплетна и тачна анализа и интерпретација свих података о ферментацији, напредна интерпретација карактеристичних параметара, изванредан научни спис 14% Тачна анализа и интерпретација већине података, напредни прорачуни изведени делимично, прихватљиво научно писање 80% Неколико прорачуна недостаје или је нетачно, непотпуно представљање података, нема напредних прорачуна, научно писање испод просека 7%
Планирање и извођење експерименталних поступака. Добро организовано планирање и израда експерименталног распореда, изванредна подела задатака и тимски рад 14% Углавном добро организовано планирање, разуман експериментални распоред, ток посла организован као тим 78% Планирање и експериментални распоред само у сарадњи са супервизором, без тимског рада евидентан 9%
  • Приказани подаци су добијени од укупно 121 ученика из одељења 2013. (59 ученика) и 2014. године (62 ученика). Ученици су оцењени према смерницама датим у наставку. Детаљи о процени доступни су као пратеће информације (С4).

Студентски лабораторијски часописи, који су садржали податке и прорачуне, као и експерименталне описе, процењени су да би се проценило разумевање студената сложене позадине и вештина научног писања. Оцењивање се фокусирало на исправност и разумевање неопходних прорачуна и тумачења заједничких карактеристичних параметара, као и на способност да се садржај курса стави у исправан контекст. Поређење ових резултата са вредностима уобичајеним за друге биореакторске системе или биопроцесе има за циљ да унапреди вештине критичког мишљења ученика. Класификација је извршена према критеријумима у табели 4, и рангирана као што је горе објашњено. Приближно 94% ученика је показало барем задовољавајуће резултате.

Примјера података

Током експеримента, ученици су морали да прате неколико параметара на мрежи и ван мреже. Ово укључује временско мерење биомасе (цИкс), онлајн праћење раствореног кисеоника (пО2), глукоза (цглц), и ацетат (цац) концентрација, анализа издувних гасова (кО2, ИксЦО2) као и запремине киселина и база које се додају у биореактор за контролу пХ. Типичан скуп резултата је приказан на слици 3. У серијском режиму, биомаса расте експоненцијално од почетне вредности на месту инокулације од приближно 0,1 г до укупно приближно 1,5 г када се почетна количина од 2,5 г глукозе исцрпи . Због преливања метаболизма, ацетат се производи и акумулира, респективно. Након завршетка серијског процеса на глукози, потрошња ацетата представља спорију стопу раста, коју представља мањи добитак у биомаси између т = 5 х и т = 6,5 ч. Профил раста у батцх режиму је даље приказан онлине параметрима пО2, ИксО2, и кЦО2. Током раста на глукози (т = 0–5 х), пО2 као и хО2 опадати док хЦО2 повећава, како се производи биомаса. Повећање пО2 ат т = 4 х (слика 3, означена звездицом) одговара повећању брзине мешалице, која је аутоматски подешена од стране софтвера за контролу процеса како би се спречило ограничење кисеоника. Након прилагођавања метаболизма од глукозе до ацетата на т = 5 х, пО2 као и хО2 повећање, због споријег метаболизма. Временски ток кЦО2 следи хО2 на супротан начин, пошто мање О2 потрошено изазива мање ЦО2 да се произведе. Треће повећање пО2 ат т = 6,5 х указује на исцрпљивање ацетата, а самим тим и на почетну тачку за прву напајану шаржу. Током фазе експоненцијалног раста, амонијак се троши као једини расположиви извор азота, што резултира потребом за подешавањем пХ вредности. База се додаје да би се одржао константан пХ, који престаје када се глукоза исцрпи. Потрошња ацетата доводи до додавања киселине (т = 5–6,5 х), респективно.

Примерни резултати онлајн и офлајн праћења процеса. Онлине подаци су доступни за пО2, ИксО2, ИксЦО2и количину додане киселине и базе за подешавање пХ. Ванмрежна мерења као апсолутне вредности су дата за биомасу, глукозу и ацетат. Различити начини рада су означени наранџастим вертикалним линијама које означавају прелазе из серије серије (т = 0–6,5 х) до прве напајане серије (т = 6,5–10,5 х) и друга серија напајања (т = 10,5–30 х). Брзина мешалице је подешена са 400 о/мин на 500 о/мин софтвером за контролу процеса да би се побољшао пренос кисеоника у бујон културе на т = 3,5 х (означено звездицом), што резултира порастом пО2 без значаја за одређивање исцрпљености супстрата. Раст биомасе у другој напајаној серији се апроксимира претпоставком експоненцијалног раста са µ = 0,1 х −1 (тамнозелена, пуна линија).

Током експоненцијалног храњења у првој напајаној серији (ФБ1, т = 6,5–10,5 х) пО2, ИксО2, ИксЦО2 а базни нивои се понашају као што је описано за серијски процес током потрошње глукозе. За одржавање сталне стопе раста од µ = 0,5 х -1, уносе се ограничене количине глукозе што резултира ограничавајућим концентрацијама глукозе у ферментационом бујону. Додавање киселине на крају првог шаржног процеса може се приписати разградњи малих нивоа ацетата који се формирају током храњења.

Друга серија за напајање почиње у т = 10,5 х, а брзина раста је подешена на µ = 0,1 х −1 подешавањем брзине храњења. Ово смањење стопе раста је представљено споријим формирањем биомасе и мањом количином глукозе која се храни да би се промовисало формирање цАМП. Ово је, поред индукције са рамнозом, која се додаје на почетку друге шарже са храњењем, предуслов за производњу рекомбинантног еГФП (погледајте одељак „Научна позадина“). Поред тога, у том тренутку, брзина гасова се повећава како би се елиминисао ризик од ограничења кисеоника при већој густини ћелија, пошто се овај корак обично изводи преко ноћи. Повећање пО2 на почетку друге шарже (ФБ2, т = 10,5–30 х) може се приписати повећању брзине гасовања, смањеној температури као и нижој брзини раста. Нема изразитих промена у кО2 и кЦО2 може се приметити током друге шарже напајања због веће брзине протока гаса.

Што се тиче приноса производа, посебно је важно контролисати додавање раствора за храну током ране фазе производње (напајана серија 2), где ће нетачна доза раствора за храну изазвати накупљање и глукозе и ацетата, чиме се драматично смањује коначни принос еГФП-а. . Подешавање температуре са 37°Ц на 30°Ц, које се обично изводи у експериментима са експресијом индуцибилног протеина да би се повећала количина правилно савијеног, активног протеина, имало је само мали ефекат на коначне нивое активног еГФП-а. Међутим, из дидактичких разлога, ово температурно померање није уклоњено из процедуре.

Визуелни резултат експеримента, флуоресценција еГФП-а је визуелизована под УВ, како у биореактору, тако и у пелетима биомасе (слика 4). На крају друге напајане серије, ат т = 25–30 х, може се приметити акумулација глукозе и ацетата. Повећање нивоа глукозе и ацетата може се приписати проблемима транспорта и мешања који се јављају при великој густини ћелија. Нехомогена култура може довести до високих локалних концентрација глукозе што изазива стварање ацетата. Поред тога, могу се јавити локални градијенти због храњења глукозом кап по кап. Штавише, узорковање смањује укупну запремину културе, што није обухваћено контролом храњења. Временом, ово може резултирати већим количинама глукозе које се додају у реактор, што доводи до потенцијалне акумулације ацетата.

еГФП-флуоресценција на крају ферментације. (а) Бактерије које производе еГФП могу се лако визуализовати у стакленој посуди биореактора коришћењем УВ светла. (б) Процес производње еГФП-а током ферментације постаје очигледан упоређивањем замрзнутих ћелијских пелета под УВ светлом.

Перцепција ученика о њиховом искуству учења током лабораторијског курса. Приказани подаци прикупљени су у оквиру званичне евалуације високог образовања на Технолошком институту у Карлсруеу (КИТ), у оквиру програма успостављеног на свим универзитетима немачке покрајине Баден-Виртемберг. Подаци о евалуацији прикупљани су анонимно у писаној форми последњег дана лабораторијског курса. Број студената који су учествовали у истраживању био је 57 (2012), 59 (2013) и 62 (2014), респективно.

На основу онлајн и офлајн мерења, студенти израчунавају и тумаче кључне параметре процеса. Ови параметри укључују укупну биомасу, максималну стопу раста (µмак), приноси биомасе за глукозу и кисеоник (ИКс/глц, ИКс/О2), брзину преноса кисеоника (ОТР) и волуметријски коефицијент преноса масе кисеоника (кЛа). Резултати узорка и типични распони су резимирани у табели 2.

Могуће модификације

Лабораторијски курс, како је описано у оквиру овог рада, захтева посебну поставку опреме и периферних уређаја поред биореактора. Међутим, постоји простор за значајне варијације, како у погледу временског оквира и обима, тако иу погледу доступне опреме. На пример, ако није доступан анализатор издувних гасова, може се користити динамичка метода за израчунавање ОТР-а, која не захтева онлајн праћење издувних гасова. Курс се лако може продужити на сесију од 2 или 3 недеље, што се може постићи проширењем обима. На тај начин, друге дисциплине попут генетике и молекуларне биологије добијају јачу заступљеност у лабораторијском курсу. Један од начина би могао бити интеграција генетског инжењеринга у недељу 1, где студенти припремају бактеријски сој за употребу у експерименту следеће недеље. Ово може укључивати амплификацију циљног гена помоћу ПЦР-а, рестрикциону дигестију одговарајућег плазмида и гена, као и лигацију и трансформацију конструкта. Недељу дана након производње рекомбинантног протеина у биореактору могло би се користити за даље процесирање. Ово се може извести коришћењем пречишћавања афинитетном хроматографијом са обележеним протеинима. Конструкт који се користи у овом лабораторијском курсу доводи до експресије 6кХис-означеног еГФП-а на Ц- и Н-крају, који се може пречистити хроматографијом са афинитетом имобилисаног метала (ИМАЦ). Чистоћа добијених фракција током пречишћавања може се затим одредити помоћу СДС-ПАГЕ уз накнадно бојење протеина, или квантификацијом коришћењем очитавања флуоресценције у комбинацији са одређивањем укупног садржаја протеина. Још једна потенцијална модификација лабораторијског курса би била измена задатака ка инжењерској перспективи. Поставка експеримента је погодна за вежбу из области управљачког инжењерства, нпр. развој и програмирање одговарајућих контролера или софтвера, нпр. за процес храњења.


  1. Припремите базу крвног агара према упутствима произвођача. Стерилисати аутоклавом на 121°Ц 15 минута.
  2. Тако припремљену базу крвног агара пребацити у водено купатило на 50°Ц.
  3. Када се база агара охлади на 50°Ц, асептично додајте стерилну крв и добро промешајте. Избегавајте стварање ваздушних мехурића. Мора да сте загрејали крв на собну температуру у време дозирања у растопљену базу агара.
    (Белешка: If you are planning to prepare a batch of blood agar plates, prepare few blood agar plates first to ensure that blood is sterile).
  4. Dispense 15 ml amounts to sterile Petri plates aseptically
  5. Label the medium with the date of preparation and give it a batch number (if necessary).
  6. Store the plates at 2-8°C, preferably in sealed plastic bags to prevent loss of moisture. The shelf life of thus prepared blood agar is up to four weeks.
  1. The pH of the blood agar range from 7.2 to 7.6 at room temperature.
  2. Inoculate the plates with 5-hour broth cultures of Стрептоцоццус пиогенес и С. пнеумониае.Inoculate also a plate with Х. инфлуензае and streak with S. aureus (i.e. Satellitism Test).
  3. Incubate the plates in a carbon dioxide enriched atmosphere at 35-37°C overnight.
  4. Check for the growth characteristics of each species
    1. С. пиогенес: Beta-hemolysis
    2. С. пнеумониае: Alpha-hemolysis

    Материјали и методе

    П. falciparum culture and maintenance

    Unless otherwise noted, blood-stage П. фалципарум parasites were cultured in human erythrocytes at 1% hematocrit in a 10 ml total volume of CMA (Complete Medium with AlbuMAX II) containing RPMI 1640 medium with l -glutamine (USBiological Life Sciences), supplemented with 20 mM HEPES, 0.2% sodium bicarbonate, 12.5 μg/ml hypoxanthine, 5 g/l AlbuMAX II (Life Technologies), and 25 μg/ml gentamicin. Cultures were maintained in 25-cm 2 gassed flasks (94% N2, 3% O2, 3% CO2) and incubated at 37°C.

    Generating markerless PfMev P230p-attB parasites

    A 1.2 kB region of the p230p gene (PF3D7_0208900) was amplified from PfMev genomic DNA using primers P230p.HA.F and P230p.HA.R (Appendix Table S2). These primers were designed to contain

    15 bp overhangs which allowed insertion of the amplicon into the NgoMIV site of pRS (Swift ет ал, 2020b ) by ligation independent cloning (In-Fusion, Clontech). The plasmid was digested with BglII to excise a 210bp fragment between two BglII sites in the p230p ген. The excised region was replaced with an oligo comprised of complementary primers attBr. InF.F and attBr. InF.R (Appendix Table S2) using In-Fusion to generate an attB site flanked by p230p homology arms. The plasmid was then digested with BsaI to insert a segment of DNA encoding a guide RNA targeting the excised region of p230p. Complementary primers P230p.gRNA.F and P230p.gRNA.R (Appendix Table S2) were annealed and inserted using ligation independent cloning with In-Fusion (Clontech). The resulting plasmid pRS-P230p was used along with pCasG (Rajaram ет ал, 2020 ) in transfections for markerless insertion of the attB element into the P230p locus of PfMev parasites. After 48 h, transfectants were selected with 1.5 μM DSM1 for 7 days and 2.5 nM WR99210 for 10 days. Parasite clones were characterized by genotyping PCRs (Fig 2A) using primers described in Fig EV1 and Appendix Table S2.

    Generation of the PfMev ЕцDPCK complementation lines

    Тхе Е. цоли complementation constructs were generated from the p15-Mev-aSFG plasmid (GenBank: MN822298) containing a bidirectional Cam/HOP promoter (Swift ет ал, 2020b ). On one side of the promoter, a drug resistance marker can be inserted into the BamHI/HindIII sites on the other side, transgenes can be inserted into the AvrII/AflII sites. The plasmid also contains an attP site for integration into PfMev P230p-attB parasites (Nkrumah ет ал, 2006 Spalding ет ал, 2010 ). Unless noted, the construction of the complementation plasmids used ligation independent cloning with In-Fusion (Clontech).

    The hDHFR drug resistance cassette was amplified from the pRS-LacZ plasmid (GenBank: MN822297) (Swift ет ал, 2020b ) using the primers listed in Appendix Table S2 (hDHFR.F and hDHFR.R) and inserted into the BamHI/HindIII sites of p15-Mev-aSFG to generate p15-hDHFR. The sequence encoding Е. цоли DPCK (ЕцDPCK) was amplified from Е. цоли genomic DNA using the primers in Appendix Table S2 (ЕцDPCK.F and ЕцDPCK.R) and inserted into the AvrII/BsiWI sites of the pLN-TP-ACP-mCherry plasmid (Gisselberg ет ал, 2013 ) to generate pLN-ЕцDPCK-mCherry. Цела ЕцDPCK-mCherry region was then amplified from this plasmid using the primers in Appendix Table S2 (CamЕцDpmCry.F and CamЕцDpmCry.R) and inserted into the AvrII/AflII sites of p15-hDHFR to generate p15-ЕцDPCK-mCherry.

    For the generation of the apicoplast-localized Е. цоли DPCK-mCherry protein, the pLN-TP-ACP-mCherry plasmid (Gisselberg ет ал, 2013 ) was cut with AvrII/BsiWI. The N-terminal signal and transit peptide, corresponding to the first 55 amino acids of the П. фалципарум ACP protein (Api55), was amplified from p15-Mev-aSFG using the primers in Appendix Table S2 (pLN. Api55.F and pLN. Api55.R) and inserted upstream of the mCherry sequence to form the pLN-Api-mCherry plasmid. The sequence encoding ЕцDPCK was then amplified from Е. цоли genomic DNA using the primers in Appendix Table S2 (Api. ЕцDPCK.F and Api. ЕцDPCK.R) and inserted into the BsiWI/BspEI sites of the previous plasmid. The resulting sequence, comprised of Api55, ЕцDPCK, and mCherry, was amplified from the pLN-Api-ЕцDPCK-mCherry plasmid using the primers in Appendix Table S2 (CamApЕцDpmC.F and CamApЕцDpmC.R) and then inserted into the AvrII/AflII sites of p15-hDHFR to generate p15-Api-ЕцDPCK-mCherry.

    The PfMev P230p-attB parasite line was transfected with either the p15-ЕцDPCK-mCherry or p15-Api-ЕцDPCK-mCherry plasmids along with the pINT plasmid encoding the bxb1 integrase (Nkrumah ет ал, 2006 Spalding ет ал, 2010 ). Integrants were selected for with 2.5 nM WR99210 for 7 days, after which point drug pressure was removed. Infected RBCs were then observed

    20–25 days post-transfection, at which point 2.5 nM WR99210 was added back, with the parasites maintained in the presence of this drug. Parasite lines were characterized by genotyping PCR (Fig EV2A and B) using primers listed in Appendix Table S2.

    Generation of the П. фалципарум DPCK localization line

    Кодирање гена П. фалципарум DPCK (PF3D7_1443700) was amplified from cDNA using the primers (DPCK.loc.F and DPCK.loc.R) listed in Appendix Table S2 and inserted into the AvrII/BsiWI sites of p15-Api55-EcDPCK-mCherry to generate p15-PfDPCK-mCherry. This plasmid was transfected into the PfMev P230p-attB parasite line along with pINT (Nkrumah ет ал, 2006 Spalding ет ал, 2010 ). Parasites were selected and validated as described above.

    Live cell epifluorescence microscopy

    Approximately 100 μl of resuspended parasite cultures was incubated with 1 µg/ml 4′, 6-diamidino-2-phenylindole (DAPI) for 30 min at 37°C. Cells were then washed three times with 100 μl of CMA medium and incubated for 5 min at 37°C after each wash. Cells were resuspended in 20 μl of CMA and then pipetted onto slides and sealed with wax for observation on a Zeiss AxioImager M2 microscope. A series of images spanning 5 µm in the z-plane were acquired with 0.2 µm spacing, and images were deconvolved using the VOLOCITY software (PerkinElmer) to report a single image in the z-plane.

    Generation of П. фалципарум plasmid constructs for gene deletion

    DPCK was targeted for deletion through Cas9-mediated gene editing, using the pL8 plasmid (Swift ет ал, 2020b ), in combination with the pUF1-Cas9 plasmid, which was generously provided by Dr. Jose-Juan Lopez-Rubio (Ghorbal ет ал, 2014 ). To generate pL8-DPCK, two DPCK homology arms (HA1 and HA2) and a 20 bp guide RNA were inserted into pL8. HA1 (562bp) was amplified with primers DPCK.HA1.F and DPCK.HA1.R, and HA2 (393bp) was amplified with primers DPCK.HA2.F and DPCK.HA2.R (Appendix Table S2). HA1 was inserted into the NotI site, and HA2 was inserted into the NgoMIV site of pL8 using In-Fusion. Primers DPCK.gRNA.F and DPCK.gRNA.R (Appendix Table S2) were annealed and inserted into the BtgZI sites of pL8 to form pL8-DPCK. For deletion of DPCK in the ЕцDPCK complementation lines, the gene encoding hDHFR in pL8-DPCK was replaced by a codon harmonized gene encoding residues 2–129 of the Аспергиллус терреус blasticidin-S deaminase (BSD) synthesized by LifeSct. The harmonized bsd gene (Appendix Fig S2) was amplified using the primers pRsBSD.F and pRsBSD.R (Appendix Table S2) and inserted into the BamHI/HindIII sites of pL8-DPCK using ligation independent cloning (In-Fusion, Clontech).

    П. falciparum transfections for attempted gene deletion of DPCK

    Transfections were conducted as previously described (Spalding ет ал, 2010 ). Briefly, 400 μl of RBCs was electroporated with 75 μg each of the Cas9 expression plasmid and the pL8-DPCK homology repair plasmid. The transfected RBCs were then mixed with synchronized schizont-stage PfMev parasites. После

    48 h, drug-selection was initiated by the addition of 1.5 μM DSM1, 2.5 nM WR99210, and 50 µM mevalonate, with or without 5 mM CoA.

    Generation of the PfMev CLD-ЕцDPCK-mCherry-apt parasite line

    In order to generate the p15-CLD-ЕцDPCK-mCherry-apt plasmid, the p15-Api-ЕцDPCK-mCherry plasmid was digested with AvrII and BspEI in order to remove the ACP signal and transit peptide sequence. The conditional localization domain sequence was then amplified from the pLN-CLD2-HCS1 plasmid (Roberts ет ал, 2019 ) using the primers listed in Appendix Table S2 (CLD.F and CLD.R). The CLD-ЕцDPCK-mCherry gene sequence was then amplified using the CLD.F and ЕцDPCK.CLD.R primers (Appendix Table S2), and inserted into the p15-aFluc-mCh plasmid (Swift ет ал, 2020a ), previously digested with AvrII and PspOMI, using In-Fusion cloning. See Appendix Fig S3 for plasmid sequence. This plasmid, along with the pINT plasmid encoding the bxb1 integrase for attP/attB integration, was transfected into p230p attB PfMev parasites and selected with 2.5 µg/ml blasticidin for 7 days, after which drug pressure was removed. Parasites were observed via Giemsa stain 20–25 days later, at which point the parasites were again cultured in the presence of 2.5 µg/ml blasticidin.

    Deletion of DPCK in the PfMev ЕцDPCK-mCherry, PfMev api-ЕцDPCK-mCherry, and PfMev CLD-ЕцDPCK-mCherry-apt lines

    The PfMev ЕцDPCK-mCherry and PfMev api-ЕцDPCK-mCherry lines were transfected with the pL8-DPCK (BSD) plasmid along with the pUF1-Cas9 plasmid. The parasites were selected with 2.5 µg/ml blasticidin and 1.5 μM DSM1 for 7 days, also in the presence of 2.5 nM WR99210. After 7 days, blasticidin and DSM1 were removed. Infected RBCs were then typically seen after

    20–25 days. After parasites were observed, the cultures were then maintained in the presence of 2.5 nM WR99210 and 2.5 µg/ml blasticidin.

    For the deletion of DPCK in the PfMev CLD-ЕцDPCK-mCherry-apt parasite line, the original pL8-DPCK plasmid containing the DPCK homology arms flanking the hDHFR drug selectable marker was used. Parasites were transfected with the pL8-DPCK (hDHFR) plasmid along with the pUF1-Cas9 plasmid. Parasites were then selected with 2.5 nM WR99210 and 1.5 μM DSM1 for 7 days, also in the presence of 2.5 µg/ml blasticidin. After 7 days, WR99210 and DSM1 were removed. Infected RBCs were then typically seen after

    20–25 days. After parasites were observed, the cultures were then maintained in the presence of 2.5 nM WR99210 and 2.5 µg/ml blasticidin. Parasites were continuously cultured in the presence of 0.5 µM aTc.

    Confirmation of knockout genotype

    Primers were designed to screen for 5’ integration (Δ5’ reaction primers DPCK.5.F and pL8HA1.R) and 3’ integration (Δ3’ reaction primers pL8HA2.F and DPCK.3.R) of the gene disruption cassette, and the 5’ region (primers DPCK.5.F and DPCK.5.WT.R) and 3’ region (primers DPCK.3.WT.F and DPCK.3.R) of the WT gene (Appendix Table S2). The parental PfMev line was used as a control for these reactions.

    Generation and purification of anti-mCherry rabbit antibodies

    Recombinant mCherry was produced to generate affinity-purified antibodies. Primers mCh.pMAL. EcoRI. For and mCh.pMAL. HindIII. Rev (Appendix Table S2) were used to amplify mCherry for insertion into the pMALcHT Е. цоли expression vector (Muench ет ал, 2003 ). mCherry was expressed and purified using the same protocol previously described for the purification of recombinant GFP (Roberts ет ал, 2019 ). Pure recombinant mCherry was used to generate rabbit antiserum using the custom antibody service of Cocalico Biologicals Inc. Briefly, 250 µg of mCherry mixed with Complete Freund’s Adjuvant was used for the initial inoculation followed by boosts of 125 µg of antigen 2, 3, and 7 weeks later. Final exsanguination was performed on day 56. Specific antibodies were purified from antiserum with a mCherry affinity column using previously described methods (Roberts ет ал, 2019 ). A total of 18.6 mg of anti-mCherry IgG was concentrated to 3.1 mg/ml and stored at −80°C in storage buffer (PBS, 40% glycerol, 0.02% NaN3).

    Western blotting

    Parasite samples were centrifuged at 500 г for 5 min at room temperature (RT), and pellets were stored at −20°C until the time of protein extraction. To isolate parasites from RBCs, the pellets were thawed and resuspended in 0.15% saponin for 5 min at RT. Lysed RBCs were removed by washing three times with PBS. Parasite pellets were resuspended in NuPAGE LDS sample buffer (Thermo Fisher) containing 2% β-mercaptoethanol and incubated at 95°C for 5 min. Proteins were resolved by SDS–PAGE on 4–12% gradient gels and transferred to nitrocellulose membranes. За детекцију ЕцDPCK-mCherry constructs, membranes were blocked in 5% milk and probed overnight at 4°C with 1:10,000 rabbit anti-mCherry (vide supra). They were then incubated for an hour at RT with 1:10,000 donkey anti-rabbit HRP-linked secondary antibodies (GE healthcare, NA934). Protein bands were detected on X-ray film using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific), according to the manufacturer’s protocol. Membranes were stripped of antibody with 200 mM glycine (pH 2.0) for 5 min and probed with 1:2,500 rat anti-HA mAb 3F10 (Roche) in order to detect api-SFG which contains a C-terminal HA tag (Swift ет ал, 2020b ). After incubation with 1:5,000 goat anti-rat HRP-linked secondary antibodies (GE healthcare, NA935), proteins were detected as described above.

    Growth curve for the PfMev CLD-ЕцDPCK-mCherry-apt Δdpck линија

    A culture of PfMev CLD-ЕцDPCK-mCherry-apt Δdpck parasites was washed four times with 10 ml of CMA in order to remove aTc. Parasites were then used to seed two separate 25-cm 2 flasks, each at 1% hematocrit in a 10 ml total volume of CMA media, and a starting parasitemia of

    0.5%. One flask was supplemented with 0.5 µM aTc, representing the permissive condition, while the other was treated with 0.5 µM Shield1, representing the non-permissive condition. The appropriate media were replaced approximately every 24 h, at which point a blood-film was made, and the parasitemia was determined via Giemsa stain. On day 4 of this growth curve, the parasitemia was diluted 1:10.

    Pantothenate titration growth curve

    Pantothenate-free media was generated, consisting of RPMI 1640 media with L-glutamine, and without pantothenate (USBiological Life Sciences #R8999-01A), supplemented with 20 mM HEPES, 0.2% sodium bicarbonate, 12.5 μg/ml hypoxanthine, 5 g/l AlbuMAX II (Life Technologies), and 25 μg/ml gentamicin. PfMev parasites were washed with 10 ml pantothenate-free media three times in order to remove the preexisting pantothenate from the culture. Parasites were then seeded into a 96-well plate at a starting parasitemia of 0.5, 2% hematocrit, and a total volume of 250 µl per well. Pantothenate was then added back to the wells containing pantothenate-free medium at a concentration of 0, 10, 50, 250 nM, or 1 μM, with CMA as a control. The appropriate media were replaced approximately every 24 h, at which point samples were collected for analysis via flow cytometry using previously described methods (Swift ет ал, 2020b ). On day 4 of this growth curve, the parasitemia was diluted 1:5. In Fig EV5, error bars represent the standard error of the mean from two independent experiments, each conducted in quadruplicate.

    Growth curves for the PfMev CLD-ЕцDPCK-mCherry-apt Δdpck line under limiting pantothenate concentrations

    The PfMev CLD-ЕцDPCK-mCherry-apt Δdpck line was washed with 10 ml pantothenate-free media four times in order to remove aTc and pantothenate. Parasites were then seeded into a 96-well plate (Corning) at a 0.5% starting parasitemia, 2% hematocrit, and a total volume of 250 µl per well in quadruplicate. Pantothenate was added back to the pantothenate-free medium to yield a final concentration of 50 nM. Two conditions were tested: The parasites were either supplemented with 0.5 µM aTc, representing the permissive condition, or with 0.5 µM Shield1, representing the non-permissive condition. The appropriate media were replaced approximately every 24 h, at which point samples were collected for analysis via flow cytometry using previously described methods (Swift ет ал, 2020b ). On day 4 of this growth curve the parasitemia was diluted 1:5. In Figs 5G and 6C, error bars represent the standard error of the mean from two independent experiments, each conducted in quadruplicate.

    Inducing apicoplast loss in the PfMev api-ЕцDPCK-mCherry Δdpck and PfMev CLD-ЕцDPCK-mCherry-apt Δdpck parasite lines

    The PfMev CLD-ЕцDPCK-mCherry-apt Δdpck line was cultured in media containing 100 nM azithromycin in the presence of 50 μM mevalonate for 7 days. After 7 days, the parasites were cultured continuously in the presence of 50 μM mevalonate. Loss of the apicoplast was confirmed via PCR using the methods described below.

    Confirmation of apicoplast loss

    The presence of the apicoplast organellar genome was detected by PCR using primers specific for the sufB gene (SufB.F and SufB.R). Control PCRs amplified the lactate dehydrogenase (ldh) gene from the nucleus (LDH.F and LDH.R) and cytochrome c oxidase subunit 1 (цок1) from the mitochondrial genome (Cox1.F and Cox1.R) (Appendix Table S2). For each PCR, 1 µl of parasite culture was added to a 50 µl reaction volume. The parental PfMev line was used as a positive control for apicoplast genome detection.


    REAGENTS AND SOLUTIONS

    FACS buffer

    • 1× Hank's Balanced Salt Solution (HBSS Gibco, cat. no. 14175-095)
    • 10 mM HEPES (Gibco, cat. no. 15630-080)
    • 0.2% BSA (Millipore, cat. no. 126626-50 ml)
    • 1× Antibiotic/Antimycotic Solution (diluted from 100×, Gibco, cat. no. 15240-062)

    HaloTag dsDNA donor sequences

    N-terminal HaloTag sequence:

    500-bp upstream homology arm-GCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGT CCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCT CCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTG CATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTG GGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAG CCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGC TCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATT GCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAG AATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCG CAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATG GGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGC CGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGA GCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGA ATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGG GGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCA AAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCT GCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTG GCTGTCGACGCTCGAGATTTCCGGCGAGCCAACCACTGAGGATCTGTAC TTTCAGAGCGATAAC-500-bp downstream homology arm

    C-terminal HaloTag sequence:

    500-bp upstream homology arm-GAGCCAACCACTGAGGATCTGTACTTTCAG AGCGATAACGATGGATCCGAAATCGGTACTGGCTTTCCATTCGACCCCC ATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTC CGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTC CTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCAT CGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAAC CAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGC CTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCAC GACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAG AGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCC GACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCC TTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACG TTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGAC TGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTT GACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCG GTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTG GCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCA GGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCC TGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCT GCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGG CTGTCTACTCTGGAGATTTCCGGT-500-bp downstream homology arm

    N-terminal HiBiT-HaloTag sequence:

    500-bp upstream homology arm-GTGAGCGGCTGGCGGCTGTTCAAGAAGA TTAGCGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGG AAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGG CACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGG CGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAG ACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTT CGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTG GAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCC ACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGA GTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGC GAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCA TCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCG CCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAAT CCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCG CCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTG GCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGC GTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTA ACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAG ACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCT CGAGATTTCCGGCGAGCCAACCACTGAGGATCTGTACTTTCAGAGCGAT AAC-500-bp downstream homology arm

    C-terminal HaloTag-VS-HiBiT sequence:

    500-bp upstream homology arm- GAGCCAACCACTGAGGATCTGTACTTTCAG AGCGATAACGATGGATCCGAAATCGGTACTGGCTTTCCATTCGACC CCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGT TGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCG ACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGA CCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGA CAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATG GATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCA TTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAA TCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCT ATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCC AGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCA GAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCG CTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATC CTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAAT CGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATG GACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCA CCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAA AAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAAT CTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGC GCTGGCTGTCTACTCTGGAGATTTCCGGTGTCTCCGTGAGCGGCTG GCGGCTGTTCAAGAAGATTAGC-500-bp downstream homology arm

    Кључ: blue, HiBiT red, HaloTag green, linker.


    Does adding antibiotic after 5-10 mins of innoculation affect the protein yield or growth? - Биологија

    a Institute for Systems Biology, 401 Terry Ave North, Seattle, USA
    Е-маил: [email protected]

    b Indi Molecular, Inc., 6162 Bristol Parkway, Culver City, CA 90230, USA

    Апстрактан

    Antibiotic resistant infections are projected to cause over 10 million deaths by 2050, yet the development of new antibiotics has slowed. This points to an urgent need for methodologies for the rapid development of antibiotics against emerging drug resistant pathogens. We report on a generalizable combined computational and synthetic approach, called antibody-recruiting protein-catalyzed capture agents (AR-PCCs), to address this challenge. We applied the combinatorial protein catalyzed capture agent (PCC) technology to identify macrocyclic peptide ligands against highly conserved surface protein epitopes of carbapenem-resistant Клебсиелла пнеумониае, an opportunistic Gram-negative pathogen with drug resistant strains. Multi-omic data combined with bioinformatic analyses identified epitopes of the highly expressed MrkA surface protein of K. pneumoniae for targeting in PCC screens. The top-performing ligand exhibited high-affinity (EC50 ∼50 nM) to full-length MrkA, and selectively bound to MrkA-expressing K. pneumoniae, but not to other pathogenic bacterial species. AR-PCCs that bear a hapten moiety promoted antibody recruitment to K. pneumoniae, leading to enhanced phagocytosis and phagocytic killing by macrophages. The rapid development of this highly targeted antibiotic implies that the integrated computational and synthetic toolkit described here can be used for the accelerated production of antibiotics against drug resistant bacteria.


    Методе

    Сојеви и плазмиди

    Е. цоли ДХ10Б је коришћен за клонирање. Е. цоли БЛР (ДЕ3) и ДХ1 су коришћени за студије експресије са БглБрицк векторима. Плазмиди и БглБрицк делови који су коришћени у овој студији наведени су у табели 1. Медији су допуњени са 100 μг/мЛ ампицилина, 35 μг/мЛ хлорамфеникола или 50 μг/мЛ канамицина да би се одабрали за одржавање плазмида. Сви сојеви су узгајани на 30°Ц осим ако није другачије описано.

    Конструкција БглБрицк векторских делова

    Шаблони плазмиди или делови за БглБрицк векторе који су овде конструисани су наведени у табели 1, а прајмери ​​за ПЦР амплификовање су наведени у табели 2. Свака компонента гена је или ПЦР амплификована из шаблона коришћењем Пхусион™ Хигх-Фиделити ДНК полимеразе (Нова Енглеска БиоЛабс, Ф-530) или дигестирани из шаблонских плазмида и уграђени у БглБрицк векторски плазмид стандардном методом рестрикцијске дигестије/лигације.

    Порекло репликације

    Порекло п15А добијено је из плазмида пЗА31-луц, порекло ЦолЕ1 из плазмида пЗЕ12-луц, а порекло пСЦ101* из плазмида пЗС*24-МЦС1 [39]. А BglII место у пореклу пСЦ101* је елиминисано мутагенезом усмереном на место. Олигонуклеотиди који се користе за уклањање BglII место у пореклу пСЦ101* били су пСЦ101КЦ Ф1 и пСЦ101КЦ Р1 који стварају пСЦ101**. Сваки модул порекла репликације и терминаторске секвенце је клониран коришћењем АврИИ и SacI сајтови. Плазмид пМБИС је коришћен као шаблон за пББР1 порекло. ББР1 регион је амплификован у два дела, а прајмери ​​су дизајнирани да направе мутацију тачке Ц до Т у региону преклапања два ПЦР производа како би се повећао број копија као што је објављено [22]. Предњи прајмер пББР1 Ф1 (5'- гатцаЦЦТАГГцтацагццгатагтцтггаацагцгц -3') и реверзни прајмер пББР1 мут Р1 (5'- ццггцаццгтгтТггццтацгтггтц -3') коришћени су за генерисање првог производа са 5'-АврИИ место, и предњи прајмер пББР1 мут Ф1 (5'- гаццацгтагггццАацацггтгццгг -3') и реверзни прајмер пББР1 Р2 (5'- агатцаАЦТАГТгццтццггццтгцггццтгцгцгцттцг -3') коришћени су за генерисање другог производа са 3'- SpeI сајту. Ова два дела су затим комбинована у реакцији проширења-ПЦР (СОЕ-ПЦР) спајања са прајмерима пББР1 Ф1 и пББР1 Р2 да би се створио производ који садржи целокупно порекло репликације пББР1. The PCR product was digested with АврИИ и SpeI и везани са постојећим интермедијерним векторима да би се генерисала три додатна интермедијарна вектора који садрже пББР1 и сваки модул отпорности на антибиотике.

    Отпорност на антибиотике

    Сви сегменти резистенције на антибиотике (SacI до AatII) су дигестирани из родитељских плазмида наведених у табели 1. БглБрицк рестрикционо место пронађено у компонентама гена отпорности на Цм и Км је уклоњено мутагенезом специфичном за место. Олигонуклеотиди који се користе за уклањање EcoRI место у гену отпорности на Цм били су предњи ЦмКЦ Ф1 (5'-цтттцаттгццатацгАааттццггатгагцаттц-3') и реверзни ЦмКЦ Р1 (5'-гаатгцтцатццггааттТцгтатггцаатгаааг-3') (тачкаста мутација је написана великим словима). Олигонуклеотиди који се користе за уклањање BglII место у Км промотору гена отпорности били су КанКЦ Ф1 (5'-ццтгтцтцттгатцагатцАтгатццццтгц-3') и КанКЦ Р1 (5'-гцаггггатцаТгатцтгатцаагагацагг-3').

    Рфп (или гфп) и терминатор

    Модул рфп-терминатора (рфп-терм) конструисан је помоћу ПЦР-а са преклапањем спајања (СОЕ-ПЦР [47]. Прво је изведен СОЕ-ПЦР да би се захтев за понуду са БглБрицк сајтовима за ограничење EcoRI и BglII и РБС (ТТТААГААГГАГАТАТАЦАТ) на 5'-крају, и са БглБрицк рестрикцијским местима БамХИ и XhoI и секвенца двоструког терминатора иза које следи ан AatII место на 3'-крају. Урађена су два ПЦР-а да би се појачала захтев за понуду и терминатор одвојено, коришћењем прајмера за увођење рестрикционих места, РБС и преклапајуће секвенце за СОЕ-ПЦР. Предњи прајмер РФП Ф1 и реверзни прајмер РФП Р1 су коришћени за генерисање производа који садржи ЕцоРИ, БглИИ, РБС и захтев за понуду. Предњи прајмер Терм Ф1 и реверзни прајмер Терм Р1 су коришћени да се добије производ који садржи БамХИ, КсхоИ, секвенца двоструког терминатора и АврИИ. Производи су затим комбиновани и други ПЦР је изведен са РФП Ф1 и Терм Р1. Добијени СОЕ-ПЦР производ (захтев за понуду-терм) је заузврат коришћен у додатним СОЕ-ПЦР-овима за генерисање комплетних модула који садрже 8 различитих промоторских система праћених захтев за понуду-term.

    Промотери и репресори

    Прајмери ​​за сваки промоторски систем (који садрже репресор и промотер) су конструисани тако да укључују 5'AatII сајт за касније кораке клонирања и ан захтев за понуду преклапајућа секвенца на 3' крају да би се олакшало додавање захтев за понуду-терминатор модул преко СОЕ-ПЦР. Када је промоторски систем садржао било које од 4 БглБрицк рестрикциона места, припремљен је додатни сет прајмера за уклањање рестриктивног места за СОЕ-ПЦР. Прајмери ​​за сваки промоторски систем су наведени у табели 2.

    Коначни пБб векторски склоп

    Да се ​​конструише промоторски систем са захтев за понуду-терминаторски модул, сваки од осам модула промоторског система је комбинован са захтев за понуду-терминатор помоћу СОЕ-ПЦР користећи Ф1 прајмер из сваке конструкције промоторског система и реверзни прајмер Терм Р1. Ових осам производа је затим дигестирано са AatII и АврИИ и појединачно везани са AatII и АврИИ дигестирани фрагмент из средњег плазмида који садржи амп Р и ЦолЕ1. Једанаест преосталих средњих плазмида је затим дигестирано са АврИИ и AatII да изолују модуле порекла резистенције на антибиотике (АР-ори). Укупно, сваки од дванаест АР-ори модула је повезан са сваким од осам АврИИ и AatII дигестед модуле промотер-рфп-терминатор за производњу 96 јединствених пБб вектора.

    Експерименти са подацима

    Генерал

    ПБб плазмиди отпорни на ампицилин су трансформисани у Е. цоли БЛР(ДЕ3) електрокомпетентне ћелије и/или Е. цоли ДХ1 електрокомпетентне ћелије и постављене на ЛБ-агар са 50 μг/мл карбеницилина (Цб) за инкубацију преко ноћи на 37 ° Ц. Једна колонија је сакупљена и коришћена за припрему културе семена у ЛБ бујону који садржи 50 μг/мл Цб. Епрувете са свежом културом са 3 мл ЛБ бујона који садржи 50 μг/мл Цб су инокулисане са 60 μл културе семена преко ноћи и узгајане на 37°Ц, 200 рпм до ОД600 достигао око 0,55. Сви експерименти су поновљени у три примерка.

    Одговор на дозу индуктора

    Спољашњи бунари плоче са чистим дном са 96 бунарчића са поклопцем (Цорнинг бр: 3631) напуњени су са 200 μл стерилне воде и плоча је стерилисана коришћењем оптимална унакрсна веза постављање на УВ умрежавач (Спецтроницс, Цорп.). Направљено је 10 × серијских разблажења индуктора одговарајућих за сваки плазмид који се тестира и 20 μл је пипетирано у сваки бунар тако да би коначна запремина од 200 μл дала 1к концентрацију индуктора. Свака плоча је укључивала 3 контролна бунара који садрже пБбЕ5а-РФП (или ГФП) у БЛР (ДЕ3) индукованом са 12,5 μМ ИПТГ. Одговарајуће запремине културе и ЛБ/Цб су додате у плочу са 96 бунарчића са поклопцем и узгајане у Сафире (Тецан) читачу микроплоча на 30°Ц током 20,5 сати. ОД600 и РФП флуоресценција су мерени сваких 570 секунди коришћењем таласне дужине ексцитације од 584 нм и таласне дужине емисије од 607 нм. За конструкте који садрже ГФП (пБбБ плазмиде), таласна дужина ексцитације од 400 нм и таласна дужина емисије од 510 нм су коришћени за мерење флуоресценције.

    Напрезање и средња зависност

    Е. цоли БЛР (ДЕ3) и ДХ1 трансформисани са пБб плазмидом су исцртани на ЛБ-агару са 50 μг/мл Цб и узгајани на 37 ° Ц преко ноћи. Културе семена су припремљене у ЛБ бујону који садржи 50 μг/мЛ Цб инокулисан са једном колонијом и узгајан на 37°Ц, 200 рпм преко ноћи. Сваки експеримент са сојем који садржи пБб плазмид је реплициран у три примерка, а сваки сет експеримената је укључивао 6 контролних епрувета које садрже пБбЕ5а-РФП у БЛР(ДЕ3) у ЛБ (3 неиндукована и 3 индукована са 100 μМ ИПТГ). За експеримент М9 минималне средине (ММ), изведена су три круга адаптације у минималном медијуму. Након адаптације, свеже епрувете са 3 мЛ свежег ММ су инокулисане са прилагођеном културом семена на ОД600 приближно 0,15 и узгајана на 37°Ц до ОД600 од приближно 0,5. Један сет епрувета је индукован на различитим концентрацијама индуктора и све културе су узгајане на 30°Ц, 200 рпм током 66 сати након индукције. Узорци су узети 18 х, 42 х и 66 х након индукције. 25 μЛ културе је узето у плочу са 96 јажица и разблажено на 200 μЛ са свежим медијумом, и ОД600 и мерена је флуоресценција. За експерименте са ЛБ и ТБ медијумима, културе семена преко ноћи су коришћене директно за инокулацију без прилагођавања.

    Репресија катаболита и преслушавање индуктора

    Културе семена су припремљене као што је описано у експериментима зависности од соја и медија. За експерименте потискивања катаболита коришћена су три различита медијума (ММ, фосфатним пуфером ЛБ и фосфатним пуфером ТБ) који садрже 1% глукозе. Инокулисане културе су узгајане на 37°Ц до ОД600 од приближно 0,5, и индукован да постигне максималну експресију (100 μМ ИПТГ, 20 мМ арабинозе, 400 нМ аТц, или 20 мМ пропионата). Културе су узгајане на 30°Ц, 200 рпм током 66 сати након индукције, и ОД600 а флуоресценција је мерена при сваком узорковању. За експеримент преслушавања индуктора, ЛБ бујон који садржи 50 μг/мл Цб је инокулисан са културама семена које садрже Е. цоли БЛР(ДЕ3) који садржи пБб отпоран на ампицилин. Културе су индуковане на ОД600 од приближно 0,5 са одговарајућим индуктором, а један од не-сродних индуктора је такође додат индивидуално индукованој култури током индукције. Културе су узгајане на 30°Ц, 200 рпм током 18 сати након индукције, и ОД600 а флуоресценција је мерена коришћењем Тецан-а.

    Изолација бактеријске ДНК за квантификацију броја копија плазмида

    Е. цоли ДХ1 и БЛР су узгајани преко ноћи на 30°Ц, 200 рпм мућкајући након инокулације 5 мЛ култура ЛБ медијума (допуњеног са 50 μг/мЛ канамицина) са појединачним колонијама из свеже пругастих плоча. После субкултивисања (1:50) у посуде за мућкање које садрже 50 мЛ ЛБ медијума (допуњеног са 50 μг/мЛ канамицина), ћелије су узгајане на 30°Ц, 200 рпм мућкањем до ОД600 од 0,3-0,4 је постигнут. У то време, 1 мЛ ћелија је центрифугиран и супернатант је затим уклоњен. Пелете ћелија су затим замрзнуте. Укупна ДНК је изолована из ових пелета за употребу у будућности. Усвојен је метод изолације ДНК описан у претходним публикацијама [33, 48]. Пелете бактеријских ћелија су ресуспендоване у 400 μЛ 50 мМ Трис/50 мМ ЕДТА, пХ 8, вортексирањем. Ћелијске мембране су пермеаблизиране додавањем 8 μЛ 50 мг/мЛ лизозима (Сигма) у 10 мМ Трис/1 мМ ЕДТА, пХ 8, након чега је уследила инкубација на 37 ° Ц током 30 минута. Да би се завршила лиза ћелија, 4 μЛ 10% СДС и 8 μЛ 20 мг/мЛ раствора протеиназе К (Инвитроген) додато је у сваку епрувету, помешано са шприцем са иглом од 21 калибра 1,5 инча и инкубирано на 50° Ц 30 мин. Протеиназа К је накнадно инактивирана топлотом на 75 ° Ц током 10 минута, а РНК је дигестирана додатком 2 μЛ 100 мг/мЛ раствора РНасе А (Киаген), након чега је уследила инкубација на 37 ° Ц током 30 минута. Потпуна екстракција ДНК је затим настављена додавањем 425 μЛ 25:24:1 фенол:хлороформ:изоамил алкохола, уз снажно мешање

    1 мин, остављајући епрувете да стоје на собној температури неколико минута, а затим центрифугирајте 5 минута на 14.000 × г, 4 ° Ц. Затим је 300 μЛ горње водене фазе пребачено у нову епрувету коришћењем врха пипете са широким отварањем. Екстракција ДНК је настављена додавањем 400 μЛ хлороформа у сваку епрувету, уз снажно мешање

    1 мин, остављајући епрувете да стоје на собној температури неколико минута, и центрифугирањем 5 мин на 14.000 × г, 4 ° Ц. Затим је 200 μЛ горње водене фазе пребачено у нову епрувету коришћењем врха пипете са широким отварањем. После екстракције хлороформом, укупна ДНК је исталожена етанолом преко ноћи, испрана са 70% етанолом и на крају ресуспендована у 40 μЛ воде без нуклеазе. Концентрација и чистоћа ДНК су анализирани коришћењем Нанодроп спектрофотометра, а интегритет је испитан на 1% агарозним геловима.

    КПЦР квантификација броја копија плазмида у реалном времену

    Сетови прајмера специфични за неомицин фосфотрансферазу ИИ (нптИИ) ген (напред: ГЦГТТГГЦТАЦЦЦГТГАТАТ, обрнуто: АГГААГЦГГТЦАГЦЦЦАТ) [49] и 16С рДНК ген (напред: ЦЦГГАТТГГАГТЦТГЦААЦТ, обрнуто: ГТГГЦАТТЦТГАТЦЦАЦГАТТАЦ) [33] коришћени су за кПЦР. Ови прајмери ​​су појачали један производ очекиване величине што је потврђено температурама топљења ампликона. нптИИ налази се у једној копији на плазмидима окарактерисаним у овој студији, док се 16С рДНК ген налази у више копија на Е. цоли хромозома [36] и коришћен је за нормализацију [22, 33, 35]. Да би се одредио број копија плазмида (тј. број плазмида по геномском еквиваленту), Е. цоли ДХ1 и БЛР трансгени сојеви са једном нптИИ интеграција (подаци нису приказани) су коришћени за калибрацију. Укупна ДНК изолована из сваког соја је прво дигестирана преко ноћи употребом ЕцоР И (Нев Енгланд Биолабс) на 37°Ц. кПЦР у реалном времену је спроведен на БиоРад иЦицлер са реакционим блоковима са 96 јажица у присуству СИБР Греен под следећим условима: 1Кс иК СИБР Греен Супермик (БиоРад), 150 нМ нптИИ (500 нМ 16С) прајмера у реакцији од 25 μЛ. кПЦР циклус у реалном времену био је 95°Ц током 3 минута, након чега је уследило 40 циклуса од 30 секунди на 95°Ц, 30 секунди на 60°Ц и 30 секунди на 72°Ц. Циклуси прага (Цт) су одређени софтвером иЦицлер (БиоРад) за све узорке. Стандардна крива је припремљена за квантификацију. У ту сврху, четворострука серија разблажења од укупно седам разблажења припремљена је од дигестираног укупног узорка ДНК, и свако разблаживање је подвргнуто кПЦР анализи у најмање дупликату са било којим нптИИ- или 16С-специфични прајмери. Добијене вредности Цт су коришћене од стране софтверског пакета иЦицлер за цртање стандардне криве која је омогућила квантификацију нптИИ или 16С у дигестираним укупним ДНК узорцима (тј. непознатим) у односу на узорак ДНК који се користи за припрему стандардне криве.

    Контрола експресије у систему са три плазмида

    БЛР (ДЕ3) ћелије су трансформисане са три плазмида: пБбА8а-ЦФП, пБбЕ5ц-ИФП и пБбС2к-РФП. Једна колонија је коришћена за инокулацију ЛБ медијума, а културе преко ноћи су узгајане на 37°Ц у минималном медијуму (М9 медијум са 75 мМ МОПС, 2 мМ МгСО4, 1 мг/Л тиамина, 10 нМ ФеСО4, 0,1 мМ ЦаЦл2 и микронутријенти) са додатком 2% глукозе. Ћелије су индуковане на ОД

    0,6 са комбинацијама различитих количина арабинозе, ИПТГ и аТц. Детаљније, коришћене концентрације арабинозе биле су 0, 5 мМ и 20 мМ, коришћене концентрације ИПТГ-а су биле 0, 30 μМ и 100 μМ, а коришћене концентрације аТц су биле 0, 12, 5 нМ, 25 нМ и 40 нМ. После индукције, ћелије су узгајане на 30°Ц током 12 сати док се не мери флуоресценција ћелијске културе. Флуоресценција ћелијске културе је забележена на СпецтраМак М2 читачу плоча (Молецулар Девицес) коришћењем Цостар плоча са 96 бунарчића, при чему је сваки бунар садржао 150 μл ћелијске културе. За ЦФП, λпр = 433 нм и λем = 474 нм је коришћено за ИФП, λпр = 500 нм и λем = 530 нм је коришћено и за РФП, λпр = 584 нм и λем = 615 нм је коришћено. Густина ћелија је процењена мерењем апсорбанције на 610 нм. Флуоресценција ћелијске културе из сваког лежишта је нормализована његовом густином ћелија. Сви подаци су просечни из најмање два независна мерења.


    Погледајте видео: Антибиотик это для тебя пдр (Август 2022).